Sequence ID | >W141814340 |
Genome ID | JQGC01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Devosia riboflavina [JQGC] |
Start position on genome | 193668 |
End posion on genome | 193593 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tgtgtcggac |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTAGAGCGTCTCGTTTACACCGAGAATGTCGGCGGTTCGAGT |
Downstream region at tRNA end position |
ttttccgttt |
Secondary structure (Cloverleaf model) | >W141814340 Val TAC c ACCA ttttccgttt G - C G - C G - C C - G G - C A - T T - A T G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |