Sequence ID | >W141815618 |
Genome ID | JQJA01000026 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Cobetia amphilecti marina [JQJA] |
Start position on genome | 51043 |
End posion on genome | 50970 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gagttggaaa |
tRNA gene sequence |
GCGGGCATAGTTTAATGGTAGAACCTCAGCCTTCCAAGCTGATGACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gttcatctcg |
Secondary structure (Cloverleaf model) | >W141815618 Gly TCC a TCCA gttcatctcg G - C C - G G - C G - C G - C C - G A - T T T T C G C C C A A A A | | | | | G T T T T G G C G G G C G + | | | T T G G A A C T A C TGAC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |