Sequence ID | >W141816321 |
Genome ID | JQJU01000006 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces atratus [JQJU] |
Start position on genome | 172597 |
End posion on genome | 172671 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gacagggcgt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGCCAGAGCAACGCACTCGTAATGCGTAGGTCTCGGGTTCGAA |
Downstream region at tRNA end position |
agaaacccca |
Secondary structure (Cloverleaf model) | >W141816321 Thr CGT t TCag agaaacccca G - C C - G C - G G - C C - G C - G T - A T A T A G C C C A T G A A | | | | | G T C T C G T C G G G C G | | | | T T G G A G C C C A A AGGTC A - T C - G G - C C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |