Sequence ID | >W141817061 |
Genome ID | JQKI01000084 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Edaphobacter aggregans DSM 19364 [JQKI] |
Start position on genome | 22491 |
End posion on genome | 22565 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gttgtagaag |
tRNA gene sequence |
GCTGATGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCATGGGTTCAAGCC |
Downstream region at tRNA end position |
ggatttgttg |
Secondary structure (Cloverleaf model) | >W141817061 Thr GGT g TCCA ggatttgttg G - C C - G T - A G - C A - T T - A G - C C G T T A C C C A G A A | | | | | A T C T C G A T G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |