Sequence ID | >W141817294 |
Genome ID | JQKO01000010 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Methylocapsa aurea [JQKO] |
Start position on genome | 59849 |
End posion on genome | 59933 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agagcgcgtt |
tRNA gene sequence |
GCCCTGGTGGCGGAATTGGTAGACGCGCTGGTTTCAGGTACCAGTGGTGAAAGCCGTGGA |
Downstream region at tRNA end position |
tacctgaaca |
Secondary structure (Cloverleaf model) | >W141817294 Leu CAG t ACCA tacctgaaca G - C C - G C - G C - G T T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGGTGAAAGCCGT C - G T - A G - C G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |