Sequence ID | >W141818029 |
Genome ID | JQLF01000011 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulfobacterium commune DSM 2178 [JQLF] |
Start position on genome | 15635 |
End posion on genome | 15710 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tcttcttaaT |
tRNA gene sequence |
CGGGACGTAGCGCAGCTTGGAAGCGCACCCGCTTGGGGTGTGGGGGGTCGGCGGTTCAAA |
Downstream region at tRNA end position |
ttttattgga |
Secondary structure (Cloverleaf model) | >W141818029 Pro GGG T ATtt ttttattgga C - G G - C G - C G - C A - T C - G G - C T A T C C G C C A C G A A | | | | | A T C G C G G G C G G C T | | | | T T G G C G C G A A A GGGTC C - G C - G C - G G + T C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |