Sequence ID | >W09119759 |
Genome ID | ACEB01000023 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium matruchotii ATCC 33806 [ACEB] |
Start position on genome | 78577 |
End posion on genome | 78653 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctttaaattt |
tRNA gene sequence |
GGGGCTATAGCTCAGTCGGTTAGAGCTGCGGACTCATAATCCGTCGGTCCCGGGTTCGAG |
Downstream region at tRNA end position |
tcatacccca |
Secondary structure (Cloverleaf model) | >W09119759 Met CAT t ACGA tcatacccca G - C G - C G - C G - C C - G T + G A - T C G T G G C C C A T G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C T T A T CGGTC G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |