| Sequence ID | >W143004119 |
| Genome ID | AZMO01000080 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans A01 [AZMO] |
| Start position on genome | 7072 |
| End posion on genome | 6997 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
tgcggtcaag |
| tRNA gene sequence |
GCCGGATTAGCTCAGACGGAAGAGCAGACGCCCCGTAAGCGTCAGGTCCGCAGTTCGATT |
| Downstream region at tRNA end position |
aaatttgaga |
| Secondary structure (Cloverleaf model) | >W143004119 Thr CGT
g ACCA aaatttgaga
G - C
C - G
C - G
G - C
G - C
A - T
T - A T T
T G C G T C A
A G A A | | | | | G
C C T C G C G C A G C
G | | | | T T
G G A G C
A A A AGGTC
G - C
A - T
C - G
G - C
C - G
C A
C A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |