Sequence ID | >W1930011848 |
Genome ID | LXWN01000002 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Candidatus Nitrosopelagicus brevis brevis U25 [LXWN] |
Start position on genome | 246641 |
End posion on genome | 246570 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttatttaga |
tRNA gene sequence |
AGCCCAGTAGTGTAGCGGCAAGCATAGGGGCCCTTGGAGCCTTTGACCTCGGTTCGAGTC |
Downstream region at tRNA end position |
tatttttaaa |
Secondary structure (Cloverleaf model) | >W1930011848 Gln TTG a Atac tatttttaaa A - T G - C C - G C - G C - G A - T G - C T G T G G G C C A C G A A | + | | | G G T G T G C T C G G C G + | | + T T C G C A T A A A TGAC G + T G + T G - C G - C C - G C A C G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |