Sequence ID | >W1930037842 |
Genome ID | QLOE01000007 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanothermobacter tenebrarum MCM B 1447 [QLOE] |
Start position on genome | 17490 |
End posion on genome | 17564 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ggagcatttt |
tRNA gene sequence |
GCGGCGTTGGTCCAGCCTGGTTAAGACACTGGCCCCCCAAGCCAGTGACCCGGGTTCAAA |
Downstream region at tRNA end position |
ttatagtgtt |
Secondary structure (Cloverleaf model) | >W1930037842 Gly CCC t ACtt ttatagtgtt G - C C - G G - C G - C C - G G - C T - A T A T G G C C C A C C G A G | | | | | A T C C T G C C G G G C G | | | T T G A G A C T T A A TGAC C - G T - A G - C G - C C - G C A C A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |