| Sequence ID | >W1920000342 |
| Genome ID | LYOR01000001 |
| Phylum/Class | Euryarchaeota |
| Species | Candidatus Syntrophoarchaeum butanivorans [LYOR] |
| Start position on genome | 112778 |
| End posion on genome | 112855 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
ggctgttcaT |
| tRNA gene sequence |
GGGGCAGTAGGGTAGCCTGGTCGATCCTCGAGCCTTTGGGAGGCTTGGACTGCAGTTCAA |
| Downstream region at tRNA end position |
tcctgtggtt |
| Secondary structure (Cloverleaf model) | >W1920000342 Pro TGG
T ATCa tcctgtggtt
G - C
G - C
G - C
G - C
C - G
A - T
G - C T A
T A C G T C A
C C G A A | | | | | A
T T G G G T G C A G C
G | | + T T
G T C C T
T C G A C GGAC
G + T
A - T
G - C
C - G
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |