Sequence ID | >R05100155 |
Genome ID | AP008218 |
Search identical group | |
Phylum/Class | Plant |
Species | Oryza sativa Japonica Group |
Chromosome | chr12 |
Start position on genome | 20637846 |
End posion on genome | 20637768 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctccaacctccgcgcctagccgcaaggaacctaaacgctggttctatcccggccaagcaagcaaggtgaaccccggtgggaaagaaagaccagggggaaA |
tRNA gene sequence |
AGCGGGGTAGAGGAATTGGTCAACTCATCAGGCTCATGACCTGAAGACTGCAGGTTCGAA |
Downstream region at tRNA end position |
Cacgtcagatacttctacgagtcctgatcacctgggtgaaagaatctatgttcaagtcgcctgcctaacaaatagacaactacgtgttctagttgctctg |
Secondary structure (Cloverleaf model) | >R05100155 Met CAT A TAAT Cacgtcagatacttctacgagtcctgatcacctgggtgaaagaatctatgttcaagtcgcctgcctaacaaatagacaactacgtgttctagttgctctg A C G - C C - G G - C G - C G - C G - C T A T T G T C C A T A A A + | | | | G T G G A G G C A G G C G | | | T T G A C T C T C A A AGACT T - A C - G A - T G - C G - C C A T G C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [RAP-DB] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |