Sequence ID | >W1930005157 |
Genome ID | FRED01000005 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus faecium [FRED] |
Start position on genome | 127338 |
End posion on genome | 127413 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
cgatgttcac |
tRNA gene sequence |
AGTAGAATAGCTTATGTTTGGTTAAAGCACTCACCTTATAAGTGAGAGAGCGTGGGTTCG |
Downstream region at tRNA end position |
actatacaaa |
Secondary structure (Cloverleaf model) | >W1930005157 Ile TAT c Ataa actatacaaa A - T G - C T - A A - T G - C A - T A - T C A T C A C C C A T G T A A | | | | | G T T T C G G T G G G C T | | | | T T G A A G C G T T A A AGAGC C - G T - A C - G A - T C - G C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |