Sequence ID | >R05100382 |
Genome ID | AP008211 |
Search identical group | |
Phylum/Class | Plant |
Species | Oryza sativa Japonica Group |
Chromosome | chr05 |
Start position on genome | 21787859 |
End posion on genome | 21787943 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttttagagtctgcagagaaagggatatgcgcgcctgtagtcttttcattctatactctgagtaaattgcataaatgcaagacgatactaaattaatcaaT |
tRNA gene sequence |
GACAGTTTGGCCGAGTGGTCTAAGGCGCCAGATTTAGGCTCTGGTCCGAAAGGGCGTGGG |
Downstream region at tRNA end position |
Tctttttcctccactgttatattttgtacgattttattttgcggggatattttgtaccaattttaacttgggccataagacttcaattactgccgtctaa |
Secondary structure (Cloverleaf model) | >R05100382 Leu TAG T AATT Tctttttcctccactgttatattttgtacgattttattttgcggggatattttgtaccaattttaacttgggccataagacttcaattactgccgtctaa G - C A - T C - G A - T G - C T + G T - A T A T C A C C C A T G A G | | | | | A G G C C G G T G G G C G | | | T T T A G G C C T A G TCCGAAAGGGC C - G C - G A - T G - C A - T T C T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [RAP-DB] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |