Sequence ID | >W1930018085 |
Genome ID | MNGZ01000020 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Thaumarchaeota archaeon 13_1_40CM_2_39_13_1 [MNGZ] |
Start position on genome | 1696 |
End posion on genome | 1623 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcgaaccaat |
tRNA gene sequence |
GCCTCGATAGCTCAGCCTGGTAGAGCGAACGCCTCGTAAGCGTTAGGCCGCGGGATCGAA |
Downstream region at tRNA end position |
cacaagttac |
Secondary structure (Cloverleaf model) | >W1930018085 Thr CGT t Tttt cacaagttac G - C C - G C - G T - A C - G G - C A - T T A T C G C C C A C G A A | | | | | G C C T C G G C G G G C T | | | | A T G G A G C G T A G AGGCC A - T A - T C - G G - C C - G C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |