Sequence ID | >W1930018428 |
Genome ID | MNWW01000058 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Woesearchaeota archaeon CG1_02_57_44 [MNWW] |
Start position on genome | 60198 |
End posion on genome | 60126 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tttccccggt |
tRNA gene sequence |
GCCTCGGTAGCTCAGTCAGTAGAGCGTGCGCTTGGTAAGCGTAAGGTCGGGAGTGCAAAT |
Downstream region at tRNA end position |
ggcccgtggt |
Secondary structure (Cloverleaf model) | >W1930018428 Thr GGT t Tgtg ggcccgtggt G - C C - G C - G T - A C - G G - C G - C T A T C C C T C A T G A A | | | | | A C C T C G G G G A G C A | | | | T G G G A G C T A G AGGTC T - A G + T C - G G - C C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |