Sequence ID | >R05100535 |
Genome ID | AP008215 |
Search identical group | |
Phylum/Class | Plant |
Species | Oryza sativa Japonica Group |
Chromosome | chr09 |
Start position on genome | 13406475 |
End posion on genome | 13406550 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
agtttttttactactgttgactgatggcctgtcgtgtgtaaatgactgtcttggcagtaaaacttttactataagaacatttcaccagcaaaatgacaag |
tRNA gene sequence |
GCCCGTCTAGCTCAGTCGGTAGAGCGCAAGGCTCTTAACCTTGTGGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
tttattttttttcaactcctctaatcacggtaactatgttttttactcatcatcacggttaattaatgaatgattcttacggatggtgaaattcacacaa |
Secondary structure (Cloverleaf model) | >R05100535 Lys CTT g GCAG tttattttttttcaactcctctaatcacggtaactatgttttttactcatcatcacggttaattaatgaatgattcttacggatggtgaaattcacacaa G - C C - G C - G C - G G + T T + G C - G C G T C A C C C A T G A A | | | | | G C C T C G G T G G G C G | | | | T T G G A G C T A G TGGTC C - G A - T A - T G - C G - C C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [RAP-DB] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |