Sequence ID | >AD01000004 |
Genome ID | NC_003070 |
Search identical group | |
Phylum/Class | Plant |
Species | Arabidopsis thaliana |
Chromosome | chr1 |
Start position on genome | 877648 |
End posion on genome | 877719 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ggagtggtggagatagagctttcggtgttggcgtcagccttcaagaaatacaaattagtttgttgttaaatagttatgttctaaacaaccaaacaacaaa |
tRNA gene sequence |
GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCC |
Downstream region at tRNA end position |
ttttttattttcggctgtacaagctaattgggccttattcttggtcccctataaatatggccctatcaatgccacttcactgacgctatacggcccataa |
Secondary structure (Cloverleaf model) | >AD01000004 Asp GTC a Gatc ttttttattttcggctgtacaagctaattgggccttattcttggtcccctataaatatggccctatcaatgccacttcactgacgctatacggcccataa G - C T + G C - G G - C T - A T - A G - C C T T G G C C C A T G A A | | | | | G G T A T G C C G G G C G + | | + T T T G T A T A A T TGAC C - G C - G C - G G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [TAIR] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |