Sequence ID | >AD01000073 |
Genome ID | NC_003070 |
Search identical group | |
Phylum/Class | Plant |
Species | Arabidopsis thaliana |
Chromosome | chr1 |
Start position on genome | 21276352 |
End posion on genome | 21276433 |
Amino Acid | Ser |
Anticodon | AGA |
Upstream region at tRNA start position |
tccttggaatcttctacttctcactcatgatcaaaatttaggatagagaatggtatacggtttagtctattttgaaataaaagtttagtttacagaaaaa |
tRNA gene sequence |
GTGGACGTGCCGGAGTGGTTATCGGGCATGACTAGAAATCATGTGGGCTTTGCCCGCGCA |
Downstream region at tRNA end position |
ttattttgagtgttggtaagtttttataattacttattgtgttttatggatcgtctttgaatttgaacggtttttcatcatgttaccgttttcagtaaac |
Secondary structure (Cloverleaf model) | >AD01000073 Ser AGA a Gttt ttattttgagtgttggtaagtttttataattacttattgtgttttatggatcgtctttgaatttgaacggtttttcatcatgttaccgttttcagtaaac G - C T - A G - C G + T A - T C - G G - C T A T C G T C C A T G A G | | | | | G G G G C C G C A G G C G + | | | T T T T C G G T A G TGGGCTTTGCCCGC C - G A - T T - A G - C A - T C A T A A G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [TAIR] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |