Sequence ID | >AD01000271 |
Genome ID | NC_003074 |
Search identical group | |
Phylum/Class | Plant |
Species | Arabidopsis thaliana |
Chromosome | chr3 |
Start position on genome | 18917433 |
End posion on genome | 18917506 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aatttgtggttgaacaaagtgataaaattggaccttcaaataaagagggaaaaacgtgtgtaattaataatttaatgcacaagtatggttagtacaatta |
tRNA gene sequence |
GCTGGAATAGCTCAGTTGGTTAGAGCGTGTGGCTGTTAACCACAAGGTCGGAGGTTCGAC |
Downstream region at tRNA end position |
tttatccttcaaatggctgttttaaaattctgattcatacttttttttttctgtctgaatagaaagttgattttgtttgaaaaatctgattcataatcat |
Secondary structure (Cloverleaf model) | >AD01000271 Asn GTT a Gttt tttatccttcaaatggctgttttaaaattctgattcatacttttttttttctgtctgaatagaaagttgattttgtttgaaaaatctgattcataatcat G - C C - G T - A G + T G - C A - T A - T C C T C C T C C A T G A A | | | | | G T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC T - A G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [TAIR] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |