Sequence ID | >AD01000302 |
Genome ID | NC_003074 |
Search identical group | |
Phylum/Class | Plant |
Species | Arabidopsis thaliana |
Chromosome | chr3 |
Start position on genome | 7319658 |
End posion on genome | 7319577 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttttgggtttgggccttcataaattaacataatcttgctggatcagcctcgtacaaattctgaagaatataagtttaaactgagaaaccttatcaaaaca |
tRNA gene sequence |
GTCGCTTTGGCCGAGTGGTTAAGGCGTGTGCCTGCTAAGTACATGGGATTTTCCCGCGAG |
Downstream region at tRNA end position |
attttttttacttttctctcgtatacattgtgacaaaatacaataatagtggcgaaacttaaaaattatgaaaaaattcatgttttgccatgccatttat |
Secondary structure (Cloverleaf model) | >AD01000302 Ser GCT a Gttt attttttttacttttctctcgtatacattgtgacaaaatacaataatagtggcgaaacttaaaaattatgaaaaaattcatgttttgccatgccatttat G - C T - A C - G G - C C - G T + G T - A T A T C T C T C A T G A G | | | | | G G G C C G G A G A G C G | | | T T T A G G C T A G TGGGATTTTCCCGC T - A G - C T - A G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [TAIR] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |