Sequence ID | >AD01000427 |
Genome ID | NC_003076 |
Search identical group | |
Phylum/Class | Plant |
Species | Arabidopsis thaliana |
Chromosome | chr5 |
Start position on genome | 24531667 |
End posion on genome | 24531739 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gaacccatcacttaagcttttagtttatcgtcacgcagtagttggaaaatatggaaaacgaaccgaattatatattaaaaatacctttataatttcggat |
tRNA gene sequence |
GCCTCCGTAGCATAGTGGTATTGCGTTCGCTTCGTAAGCGAAAGGCCGCGAGTTCGATCC |
Downstream region at tRNA end position |
attgattttgtcttctttagaaaatttgtgagctctttctcctttatttttacagcccaatagcgtgttccctttgtgcgcttatgtcccggtcctccac |
Secondary structure (Cloverleaf model) | >AD01000427 Thr CGT t TCat attgattttgtcttctttagaaaatttgtgagctctttctcctttatttttacagcccaatagcgtgttccctttgtgcgcttatgtcccggtcctccac G - C C - G C - G T + G C - G C - G G - C C T T C G C T C A G A A | | | | | G T T A C G G C G A G C G | | | T T G T T G C T A G AGGCC T - A T - A C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [TAIR] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |