Sequence ID | >W1910004346 |
Genome ID | AUUU01000028 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium sp. LS [AUUU] |
Start position on genome | 104828 |
End posion on genome | 104754 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttaaatatat |
tRNA gene sequence |
GCTCCTATAGTTAAATGGATAGAACAATCCCCTCCTAAGGGATAGATGTGAGTTCGATTC |
Downstream region at tRNA end position |
aattaaacta |
Secondary structure (Cloverleaf model) | >W1910004346 Arg CCT t ACCA aattaaacta G + T C - G T - A C - G C - G T + G A - T T T T C G C T C A T A A A | + | | | G G A T T G G T G A G C G | | | T T A G A A C T A A AGAT A - T T - A C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |