Sequence ID | >W1910006648 |
Genome ID | BBJN01000009 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halolamina rubra CBA1107 [BBJN] |
Start position on genome | 10647 |
End posion on genome | 10575 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
attcgggtgc |
tRNA gene sequence |
GGGCTCGTAGATCAGTGGTAGATCGCTTCCTTCGCAAGGAAGAGGCCCTGGGTTCAAATC |
Downstream region at tRNA end position |
gcgttacgct |
Secondary structure (Cloverleaf model) | >W1910006648 Ala CGC c ACtc gcgttacgct G - C G - C G + T C - G T - A C - G G - C T A T G A C C C A G A A | | | | | A T C T A G C T G G G C G | | | | T T G G A T C T A G AGGCC C - G T - A T - A C - G C - G T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |