Sequence ID | >W1910006713 |
Genome ID | BBJO01000037 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halobellus rufus CBA1103 [BBJO] |
Start position on genome | 11638 |
End posion on genome | 11554 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gacactgcga |
tRNA gene sequence |
GCGTGGGTAGCCAAGCCAGGCCAACGGCGCAGCGTTGAGGGCGCTGTCCCATAGGGGTCC |
Downstream region at tRNA end position |
cacggcggca |
Secondary structure (Cloverleaf model) | >W1910006713 Leu GAG a Atcg cacggcggca G - C C - G G - C T - A G - C G - C G - C T A T T G G C C A C C G A A + | | | | A A A C C G G C C G G C G | | | T T G C G G C C C A A G TCCCATAGGGGTCC C - G A - T G - C C - G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |