Sequence ID | >W1910006979 |
Genome ID | BBQX01000174 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas sp. MBEE15 [BBQX] |
Start position on genome | 983 |
End posion on genome | 907 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gaccatgttt |
tRNA gene sequence |
GTCCCTGTAGCTCAGTAGGATAGAGCAGCCGCCTCCTAAGCGGCAGGTCGCAGGTTCGAC |
Downstream region at tRNA end position |
actggggttc |
Secondary structure (Cloverleaf model) | >W1910006979 Arg CCT t GCCA actggggttc G - C T - A C - G C - G C - G T - A G - C T C T C G T C C A T G A A | | | | | G A C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTC G - C C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |