| Sequence ID | >W1910015291 |
| Genome ID | BDMD01000011 |
| Phylum/Class | Thermoproteota |
| Species | Aeropyrum pernix YK1-12-2013 [BDMD] |
| Start position on genome | 39914 |
| End posion on genome | 39989 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
taacggagga |
| tRNA gene sequence |
GCCGCCGTAGCTCAGCCGGCAGAGCGCCGCCCTGGTAAGGCGGAGGCCCCGGGTTCGAAT |
| Downstream region at tRNA end position |
cccccatgcc |
| Secondary structure (Cloverleaf model) | >W1910015291 Thr GGT
a TCCA cccccatgcc
G - C
C - G
C - G
G - C
C - G
C - G
G - C T A
T G G C C C A
C G A A | | | | | G
C C T C G C C G G G C
G | | | | T T
G G A G C
C A G AGGCC
C - G
C - G
G - C
C - G
C - G
C A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |