Sequence ID | >W1910015387 |
Genome ID | BDOQ01000006 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Novimethylophilus kurashikiensis La2-4 [BDOQ] |
Start position on genome | 261294 |
End posion on genome | 261370 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tctcaacaac |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACTTGGCTACGAACCAAGGGGTCAGGAGTTCGAA |
Downstream region at tRNA end position |
aataaaacaa |
Secondary structure (Cloverleaf model) | >W1910015387 Arg ACG c GCCA aataaaacaa G - C C - G G - C C - G C - G C - G G - C T A T T T C T C A C G A A | + | | | G T C T C G A G G A G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |