Sequence ID | >W1910020674 |
Genome ID | BDUJ01000002 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Nitratidesulfovibrio sp. HK-II HK-II [BDUJ] |
Start position on genome | 154787 |
End posion on genome | 154712 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ctctcttacg |
tRNA gene sequence |
GCGGATGTAGCTCAGTTGGCAGAGCACCTGGTTGTGGCCCAGGTGGCCGTGGGTTCAAGT |
Downstream region at tRNA end position |
ttgattccgt |
Secondary structure (Cloverleaf model) | >W1910020674 His GTG g CCCA ttgattccgt G - C C - G G - C G + T A - T T - A G - C T G T T A C C C A T G A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C C A A TGGCC C - G C - G T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |