Sequence ID | >W1910054878 |
Genome ID | BEQI01000047 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli O26:H11 PV942 [BEQI] |
Start position on genome | 12925 |
End posion on genome | 13001 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
ccatcacata |
tRNA gene sequence |
CCGCCATTAGCTCATCAGGAAAGAGCGCCAGCTTTCGAAGCTGGTTGCGCGGAGTTCGGG |
Downstream region at tRNA end position |
ttatctgtat |
Secondary structure (Cloverleaf model) | >W1910054878 Arg TCG a TCCA ttatctgtat C - G C - G G - C C - G C - G A A T - A T G T G C C C C G C T A A | | | | G A C T C G C G G A G C G | | | | T T G G A G C A A A G TTGCG C - G C - G A - T G - C C - G T A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |