| Sequence ID | >W1910067137 |
| Genome ID | BEWT01000006 |
| Phylum/Class | Thermoproteota |
| Species | Desulfurococcaceae archaeon AG1 [BEWT] |
| Start position on genome | 26126 |
| End posion on genome | 26200 |
| Amino Acid | Arg |
| Anticodon | CCG |
| Upstream region at tRNA start position |
aataggtata |
| tRNA gene sequence |
GGGCCCGTAGCTCAGCCAGGACAGAGCACCGGCCTCCGGAGCCGGAGGACCCGGGTTCAA |
| Downstream region at tRNA end position |
ctagtaactg |
| Secondary structure (Cloverleaf model) | >W1910067137 Arg CCG
a Gttt ctagtaactg
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T G G C C C A
C C G A A | | | | | A
A C T C G C C G G G C
G | | | | T T
G G A G C
A C A A AGGAC
C - G
C - G
G - C
G - C
C - G
C A
T G
C C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |