| Sequence ID | >W1910067140 |
| Genome ID | BEWT01000006 |
| Phylum/Class | Thermoproteota |
| Species | Desulfurococcaceae archaeon AG1 [BEWT] |
| Start position on genome | 26718 |
| End posion on genome | 26632 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
gatggcagaT |
| tRNA gene sequence |
GCCGGGGTGCCCGAGCGGTCTAAGGGGCCGGCCTTGAGAGCCGGTGGGGGAAACCCCGCG |
| Downstream region at tRNA end position |
atatcctgac |
| Secondary structure (Cloverleaf model) | >W1910067140 Ser TGA
T GTCa atatcctgac
G - C
C - G
C - G
G - C
G - C
G - C
G - C T A
T C G C C C A
C G A G | | | | | G
G G C C C G C G G G C
G | | | T T
T A G G G
C T A G TGGGGGAAACCCCGC
C - G
C - G
G - C
G - C
C - G
C A
T G
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |