Sequence ID | >W1910067425 |
Genome ID | BFAX01000002 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanofervidicoccus abyssi HHB [BFAX] |
Start position on genome | 70530 |
End posion on genome | 70617 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aggttgcggt |
tRNA gene sequence |
GCAGAGGTAGTCTAGCCCGGTAAGGCGTGGGACTGGAGATCCCATGGGGCTTTGCCCCGC |
Downstream region at tRNA end position |
tttttttgtt |
Secondary structure (Cloverleaf model) | >W1910067425 Ser GGA t GCCA tttttttgtt G - C C - G A - T G - C A - T G - C G - C T A T C C C C C A C G A A | | | | | A C T C T G G G G G G C C | | + | T T G A G G C G T A G TGGGGCTTTGCCCCGC T - A G - C G - C G - C A - T C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |