Sequence ID | >W1910067426 |
Genome ID | BFAX01000002 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanofervidicoccus abyssi HHB [BFAX] |
Start position on genome | 74173 |
End posion on genome | 74250 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttttcacgt |
tRNA gene sequence |
GGGACTGTGGGGTAGCCTGGTCCATCCTGCGCGTCTGGGGGGCGCGCGACCCGAGTTCAA |
Downstream region at tRNA end position |
tttttttatt |
Secondary structure (Cloverleaf model) | >W1910067426 Pro TGG t ACCA tttttttatt G - C G - C G - C A - T C - G T - A G - C T A T G G C T C A C C G A G | | | | | A T T G G G C C G A G C G | + | | T T G A T C C T C C T GCGAC G - C C - G G - C C - G G G T G C G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |