Sequence ID | >W1910112304 |
Genome ID | BGCV01000142 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli NS-NP030 [BGCV] |
Start position on genome | 16512 |
End posion on genome | 16588 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gggccgctat |
tRNA gene sequence |
CCGCCACTGGCTCATCGGGAAAGAGCATCAACCTTCTAAGTTGACTGTGCGAGGTTCGAG |
Downstream region at tRNA end position |
gtactgattt |
Secondary structure (Cloverleaf model) | >W1910112304 Arg TCT t CCCA gtactgattt C - G C - G G - C C - G C - G A - T C - G T G T C C T C C A C T A G | | | | G G C T C G C G A G G C G | | | | T T G G A G C A A A A CTGTG T - A C - G A - T A - T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |