Sequence ID | >W1910128795 |
Genome ID | BHWZ01000006 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius DP-5 [BHWZ] |
Start position on genome | 418863 |
End posion on genome | 418938 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
taaattagtg |
tRNA gene sequence |
GGGCCCGTGGTCTAGCTAGGATTAGGATGCGGCGTTCGGGTCGCCGTGGTCCCGGGTTCA |
Downstream region at tRNA end position |
tacaaagtct |
Secondary structure (Cloverleaf model) | >W1910128795 Pro CGG g Aaac tacaaagtct G - C G - C G - C C - G C - G C - G G - C T A T G G C C C A T C G A G | | | | | A A T C T G C C G G G C G + | | + T T G G G A T A T T A G TGGTC C - G G - C G - C C - G G - C T T T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |