Sequence ID | >WENV002485 |
Genome ID | AACY020069770 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 1511 |
End posion on genome | 1586 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tcgatttagc |
tRNA gene sequence |
AGCCCGGTAGTGTAGCGGTCAAGCATAGAGGCCTTTGAAGCCTTTGACCCCAGTTCGAGT |
Downstream region at tRNA end position |
tatttaataa |
Secondary structure (Cloverleaf model) | >WENV002485 Gln TTG c ACTT tatttaataa A - T G - C C - G C - G C - G G - C G - C T G T G G G T C A C G A A | | | | | G G T G T G C C C A G C G + | | + T T T G C A T C A A A TGAC G + T A - T G - C G - C C - G C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |