Sequence ID | >W1910180352 |
Genome ID | BJLB01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterocloster clostridioformis NBRC 113352 [BJLB] |
Start position on genome | 2684693 |
End posion on genome | 2684622 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ttacctttaa |
tRNA gene sequence |
GGCCTGATGGTCAAGCGGCTAAGACGACGCCCTCTCACGGCGTAAACCCGGGTTCGATTC |
Downstream region at tRNA end position |
tggcaaggct |
Secondary structure (Cloverleaf model) | >W1910180352 Glu CTC a Atga tggcaaggct G - C G + T C - G C - G T - A G - C A - T T T T G G C C C A C G A G | | | | | G G A C T G C C G G G C G | | | T T C A G A C T A G AAAC A - T C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |