Sequence ID | >W1910183770 |
Genome ID | BJNZ01000035 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cellulosimicrobium cellulans NBRC 15516 [BJNZ] |
Start position on genome | 14201 |
End posion on genome | 14273 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
accacccttg |
tRNA gene sequence |
GGGCGATTGGCGCAGCGGTAGCGCGCTTCCCTGACACGGAAGAGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
gcacgacgcg |
Secondary structure (Cloverleaf model) | >W1910183770 Val GAC g ACga gcacgacgcg G - C G - C G - C C - G G - C A - T T - A C T T T G A C C A G A G | | | | | G C C G C G A C T G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |