Sequence ID | >W1910185912 |
Genome ID | CBVC010000058 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas campestris pv. campestris str. CN19 [CBVC] |
Start position on genome | 18252 |
End posion on genome | 18328 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccgcttctgc |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
agttttgata |
Secondary structure (Cloverleaf model) | >W1910185912 Met CAT c ACCA agttttgata T T G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | | | | | A C C G A G G C A G G C T | | | | T T G G C T C G C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |