Sequence ID | >C09110831 |
Genome ID | CP001233 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cholerae M66-2 [CP001233, CP001234] |
Start position on genome | 539080 |
End posion on genome | 539156 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
taaacactgc |
tRNA gene sequence |
GCGCTCGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
ctatttaaag |
Secondary structure (Cloverleaf model) | >C09110831 Arg ACG c GCCA ctatttaaag G - C C - G G - C C - G T - A C - G G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | + T T G G A G T A T A A CGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |