Sequence ID | >W1910199452 |
Genome ID | FBWA01000013 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Agrobacterium tumefaciens 1 str. TT111 [FBWA] |
Start position on genome | 170780 |
End posion on genome | 170854 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
atggatttga |
tRNA gene sequence |
GCGGGTGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGGGTTCAAATC |
Downstream region at tRNA end position |
aatttcccag |
Secondary structure (Cloverleaf model) | >W1910199452 Gly GCC a TCCA aatttcccag G - C C - G G - C G - C G - C T + G G - C T A T T T C C C A G A A + | | | | A G C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |