Sequence ID | >W1910199464 |
Genome ID | FBWB01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Agrobacterium tumefaciens 1 str. S56 [FBWB] |
Start position on genome | 593831 |
End posion on genome | 593906 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaggtgttaa |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCGGCGGTCTCCAAAACCGCAGGTCGTAAGTTCGAGC |
Downstream region at tRNA end position |
ctttccatcc |
Secondary structure (Cloverleaf model) | >W1910199464 Trp CCA a GCCA ctttccatcc A - T G - C G - C G - C G - C T + G A - T C G T C A T T C A T G A A | | | | | G T C T C G G T A A G C G | | | | T T G G A G C T A G AGGTC G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |