Sequence ID | >W1910201269 |
Genome ID | FJPM01000057 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus agalactiae [FJPM] |
Start position on genome | 13179 |
End posion on genome | 13249 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tagaaaagta |
tRNA gene sequence |
GCCGCTATAGTTAAATGGTATAATAGAGCAATGGTAATGCTCAGTTCCGAGTTCAATTCT |
Downstream region at tRNA end position |
aatatatgag |
Secondary structure (Cloverleaf model) | >W1910201269 Thr GGT a Agaa aatatatgag G - C C - G C - G G + T C - G T + G A - T T T T G G C T C A A A A | | | | | A T A T T G C C G A G C G | | | + T T G T A A T T A A AGTT G - C A - T G - C C - G A - T A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |