Sequence ID | >W1910204647 |
Genome ID | FJUE01000012 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus agalactiae [FJUE] |
Start position on genome | 93200 |
End posion on genome | 93271 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tttttactag |
tRNA gene sequence |
GTCCCCTTAGTTCAATGGATATAACAACTCCCTCCTAAGGAGTAATTGCTGGTTCGATTC |
Downstream region at tRNA end position |
tcattgcatg |
Secondary structure (Cloverleaf model) | >W1910204647 Arg CCT g Atat tcattgcatg G - C T - A C - G C - G C - G C - G T - A T T T C G G C C A T A A A | | + | | G G C T T G G C T G G C G | | | T T A T A A C T A A AATT A - T C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |