Sequence ID | >W1910207471 |
Genome ID | FLMQ01000057 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Thiomonas delicata DSM 16361 [FLMQ] |
Start position on genome | 74231 |
End posion on genome | 74307 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gcttggtcga |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACCTGCATGGGGTGCAGGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
ataagagtgg |
Secondary structure (Cloverleaf model) | >W1910207471 Pro GGG a ACCA ataagagtgg C - G G - C G - C G - C G - C C - G G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |