Sequence ID | >W1910208716 |
Genome ID | FLUY01001030 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Candidatus Thiosymbion oneisti ectosymbiont of Laxus oneistus [FLUY] |
Start position on genome | 8705 |
End posion on genome | 8781 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ggaacgaatc |
tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGCTGGTTCAAC |
Downstream region at tRNA end position |
cttaaatttc |
Secondary structure (Cloverleaf model) | >W1910208716 Ile GAT c ACCA cttaaatttc G - C G - C G - C T - A C - G T - A G - C T C T C G A C C A C G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |