Sequence ID | >W1910209042 |
Genome ID | FLYE01000004 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Candidatus Terasakiella magnetica PR1 [FLYE] |
Start position on genome | 84066 |
End posion on genome | 83990 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttcccattgt |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGTTAGAGCGTCGGCCTGTCACGCCGAAGGCCGCGAGTTCGAG |
Downstream region at tRNA end position |
tttaaaaaag |
Secondary structure (Cloverleaf model) | >W1910209042 Asp GTC t GCCA tttaaaaaag G - C G + T G - C G + T G - C T - A G - C T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T T A G AGGCC T - A C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |