Sequence ID | >W1910217586 |
Genome ID | FMMM01000041 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Tannerella forsythia UB20 [FMMM] |
Start position on genome | 19387 |
End posion on genome | 19472 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaaaacctat |
tRNA gene sequence |
GGAGAGATGGTAGAGTGGTCGATTACAGCGGTCTTGAAAACCGCCGTACCGAAAGGTACC |
Downstream region at tRNA end position |
acaggggtgt |
Secondary structure (Cloverleaf model) | >W1910217586 Ser TGA t GCaa acaggggtgt G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | + | | | G G G A T G G G G G G C G + | | | T T T T T A C C G A A CGTACCGAAAGGTACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |