Sequence ID | >W1910225869 |
Genome ID | FMSX01000021 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium sp. MC3 [FMSX] |
Start position on genome | 269270 |
End posion on genome | 269344 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttgcgacgtc |
tRNA gene sequence |
GCCCCAGTAGCCCAATTGGCAGAGGCAACGGATTCAAAACCCGTCCAGTGTGAGTTCGAG |
Downstream region at tRNA end position |
cacccggcca |
Secondary structure (Cloverleaf model) | >W1910225869 Leu CAA c ACaa cacccggcca G - C C - G C - G C - G C - G A - T G - C T G T C A C T C A T A A A | | | | | G T C C C G G T G A G C G | | | T T G A G G C C A G A CCAGT A - T C - G G - C G - C A C T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |